Inside Outside Attendance x2 More than the numbe Dead Sea on people came to the Museum in 2000 —nearly double ve years ago—thanks in part to exhibitions about Sue, the , Russian gold, Star Wars and masks of the world. “RP. GT's Xx Outside We reached 15 million people through electronic media—a jump from one e - Access x 15 million in 1996 — offering schoolchildren online curriculum and researchers worldwide access to our collections, including 100,000 botanic specimens. sf eres Members +95% Museum members—now exceeding 43,000 households, up from 22,000 two years ago—were invited behind the scen €s for private viewings of irreplaceable specimens such as 100-year-old Am erican Crow eggs. 5 ae a |. Staff members were awarded more than. $6 million in grants in 2000— San .* ‘ fa “an increase from $1.8 million in 1995—for r esearch in anthropology geology, zoology and conservation science. o 5 : o = : ea . be —* , ° a = . a ; Inside = E = | rome ‘Significant additions to our far-reaching collections durit | wien ! Jring 2000 2 1.) Million included d the fossil remains of the world’s oldest advanced mammal Artifacts and Specimens | and the 1826 journal of John James Audubon. | Outside oe a. Pager reer ee a ne eae end, = Se = ’ ; 72a. ~< =f 9 3 (3 . ; Field Museum scientists were at work on every continent, discovering ountr 1€S new species, studying humanity and conserving biodiversity in countries from Argentina to Zimbabwe. TO FRIENDS OF THE FIELD MUSEUM What makes a museum “the best”? With this question, our former Board Chair Judith S. Block led us on a two-year endeavor to create a clear blueprint for the continued growth and development of The Field Museum. We believe the answer lies in presenting nature and culture so that our visitors are as excited, engaged and enriched as our staff inside the Museum. In 2000, we made tangible, measurable progress toward this goal. Field Museum scientists collaborated with conservation organizations and local citizens to protect at-risk environments as far away as Bolivia and the Philippines and as close as Lake Calumet. We brought the Dead Sea Scrolls to the Midwest and Kremlin treasures out of Russia. We debuted the most famous dinosaur on earth—Sue, the Tyrannosaurus rex. And we produced more than 3,000 programs for people of all ages and interests. In parallel with the growth in the public museum, we have expanded our scientific staff by almost 50 percent in the past five years, the first significant increase in four decades. Thank you for making this a great year. Ronald J. Gidwitz John W. McCarter, Jr. Chairman of the Board of Trustees President and Chief Executive Officer The Joy of Discovery “Wow.” “Unbelievable.” “| didn’t know that.’ “Impressive.” This is how people of all ages reacted during the year as they witnessed the unveiling of Sue, explored subterranean life in Underground Adventure and learned of the Museum's ongoing scientific exploration. In recent fieldwork, our 75 Ph.D. scientists led teams that uncovered the world’s smallest primates in Madagascar, mapped African trade routes, identified the first signs of agriculture in the New World and protected say a a le hundreds of threatened species in Bolivia. Discoveries such as these outside the Museum create the content for visitor discoveries inside the Museum. UNEARTHING PREHISTORIC CREATURES including species new to science. Among GREAT AND SMALL Digging their finds: jawbones from two plant-eating in a sandy rift basin in Madagascar, an dinosaurs—now considered the oldest international team of paleontologists led by dinosaurs on record—and a species of cat- Dr. John J. Flynn, MacArthur Curator of like Tribosphenida as tiny as a shrew. Fossil Mammals, discovered a treasure All three animals lived about 230 million trove of fossils of long-extinct animals, years ago. Curators Adjunct Curators a Associates — ene Research Associates Collections / Technical Resident Graduate Students — Interns Volunteers eee Other . * Center for Cultural Understanding and Change; Environmental and Conservation Programs MAPPING THE ORIGINS OF CHINESE an area almost the size of Chicago— ‘. CrveLInATION | outside | In collaboration _ searching the surface for artifacts such as nb ooo cpa Ca | with Shandong University, Dr. Gary polished stone tools and pottery sherds, ee mee i Vabdcbs | Underground Adventure | Feinman, Curator of Archaeology and This past season, they recorded more than $'Ns as visitors shrink smaller than a penny to meet denizens of the dirt on their home turf. This bug’s-eye view of some of the Museum's most relevant Ethnology, and Dr. Anne Underhill, Boone —_150 ancient settlements that range in date Assistant Curator of Asian Anthropology, between 2800 BCE and 200 CE Whil . e are charting the rise of civilization in away, Dr. Feinman shared the dj ci en e discoveri Te R aie Cae eastern Shandong province. Using _ through emails to students, teachers sb — on biodiversity explores a subter- , regional archaeological surveys, the team friends of the Museum. ve world inhabited by plants, fungi, has walked 500 square kilometers — nematodes and bacteria normally invisible 12 | | to the human eye, ij THE WORLD’S MOST FAMOUS DINOSAUR - toside | In May 2000, 67-million-year- old Sue, the largest and most complete Tyrannosaurus rex ever found, made her for- mal debut to record-breaking crowds. For two years before that, the public followed Sue's progress through the glass walls of our McDonald’ Fossil Preparation Laboratory and at Disney World in Orlando, Florida as Field Museum staff painstakingly cleaned, repaired and assembled the seven-ton-when- alive 7. rex named for her discoverer Sue Hendrickson. In the process, Museum scientists made startling discoveries: Sue's foot structure and other anatomy support the theory that birds are “living dinosaurs” and a CT scan of Sue's five-foot-long skull shows that the olfactory bulbs at the front of the brain are nearly as large as Sue’s brain itself, which suggests one of the reasons 7. rex survived for two million years. A CENTURY OF AFRICAN EXPLORATION | Outside | From the Museum’ earliest years, our scientists have been engaged in fieldwork in many parts of Africa. Today, we continue to explore the continent's natural and cultural richness, fielding more than 25 ongoing programs that research everything from late Cretaceous crocodiles in Madagascar to the evolutionary relation- ships within families of ferns and spiders in South Africa. Building on the Museum's four-year relationship with Uganda's Makerere University, Dr. David Willard, Collection Manager of Birds, is directing GAMBIA GUINEA: BISSAU ATLANTIC OCEAN additional long-term projects, including training graduate students from Uganda, Burundi, Rwanda and Democratic Republic of Congo to document biodiversity and study its evolution in the Albertine Rift of central Africa. Another program—coordi- nated by Dr. John Bates, Assistant Curator of Birds, Dr. Julian Kerbis Peterhans, Adjunct Curator of Mammals, and their colleagues—will revitalize research stations near Lake Tanganyika and Kahuzi-Biega National Park in eastern DRC and assist in developing outreach initiatives in the region. INDIAN OCEAN SECRETS OF THE TAITA CAVES | Outside | In recent explorations in Kenya, Dr. Chapurukha Kusimba, Associate Curator of Archaeology and Ethnology, discovered Taita shrine caves. Although the earliest Christians in Kenya, the Taita exhumed their ancestors’ heads and placed them in shrines for veneration and ritual feeding; the shrines continue to be tended today. Artifacts from the caves may document global trade activity in precolonial Africa, while the skulls may yield mitochondrial DNA, which could act as a “molecular clock” to track human change over the past two millennia. THE CHARACTER OF A CONTINENT ce The Museum's Affica exhibition presents a window into the civilizations that helped shape the continent's past, its present and its people. The exhibition displays art, animals, plants, musical instruments, textiles and tools from the Museum's vast collection. Visitors can witness intricate artwork from the Oba of Benin’s palace in what is now Nigeria, watch a masked dance performed by the Bamum people of Cameroon and tour land forms from lush mountain rain forest to parched desert. A favorite fieldtrip stop, Africa helps schoolchildren trace a heritage that contributes so significantly to Chicago's culture today. TALKING ROOTS = = Complementing the Africa exhibition is a dynamic array of educational and cultural programs. For example, during our annual African Heritage Festival in 2000, visitors heard Wole Soyinka, the first Nobel Prize winner from Africa, discuss the changing political framework in the western part of that continent. They experienced centuries-old folktales and contemporary peetry by Chicagoans, sampled indigenous libations and local African cuisine and talked with a Sierra Leonean chief, as well as Museum scientists who studied Kenya’s fabled lions of Tsavo. > € Ss. ar Ce A Universal Audience In 2000, we offered the most diverse palette of exhibitions and programs in our history. We reached people who had never been to The Field Museum and we built the expectation that there is always something new at the Museum for everyone. We achieved this success through a network of local and global partnerships with the Chicago Park District: Chicago Public Schools; Museums in the Park, including our Museum Campus partners Adler Planetarium & Astronomy Museum and Shedd Aquarium: Israe! Antiquities Authority; The British Museum: The State Museums of the Moscow Kremlin; and others. We collaborated on new projects and attracted the world’s best traveling exhibitions. including The Endurance: Shackleton’s Legendary Antarctic Expedition and Star Wars: The Magic of Myth. Overall attendance topped 2.36 Million. — EXPOSURE TO 17 MILLION TRAVELERS A YEAR | Ovtsid Most retail establish- to attract customers. Installed in collaboration with United Airlines and the ments use signs, but The Field Museum’s Department of Aviation, the Brachiosaurus ‘ ‘ . D “9 new store at O’Hare International Airport proclaims Chicago as the world’s destination prefers a four-story cast of a Brachiosaurus for dinosaur fans. seca eo aaah ~ BROAD APPEAL OF THE DEAD SEA SCROLLS =). © In collaboration with the Israel Antiquities Authority, the Museum presented The Dead Sea Scrolls, selections from 15 scrolls, including some never seen outside Israel. Written in Hebrew, Aramaic and Greek more than 2,000 years ago, the scrolls contain what are likely the oldest surviving copies of books of The Bible. The exhibition attracted people of many traditions and prompted discussions in synagogues, churches and community centers throughout Chicago and the Midwest. TN 9434°s5 T1747 UAV a Ht Yo *As19 fi005 Sov 4D DBAs oe we 4 €A ne 45 snynrawe yt Ny *) 7 . * At Lis Rosen iy HAA ih tk oY ¢ \ ; ~ Aa \ AXONAL Vy { *i = BAL std i: ‘oe 4 [i s BRINGING THE MUSEUM To THE CLASSROOM | Outsicie | In 2000, 358,000 school kids came to The Field Museum. And we reached almost as many students outside the Museum thanks to the Harris Educational Loan Center, Through this Program, classroom teachers borrow arti- facts, specimens and interactive materials from the Museum, The Center is part of a larger outreach to give educators the training " and resources to inte- grate the excitement of natural history into their daily lessons and inspire the next gener- ation of scientists, "“ n sty 1} vv ras? an Vat Vv) wh as baie ates re maT IDA Se DAS ans eau AS sh) hy Us BOB a: ek + 4 " ne < Tyr Say } . MF Fh. J44 { Be ue r) ay 4 RARE LOOK AT RUSSIAN RICHES ‘eside | The Field Museum partnered with the Houston Museum of Natural Science and The State Museums of the Moscow Kremlin to produce Kremlin Gold: 1000 Years of Russian Gems and Jewels. This opulent collection of sacred and secular Masterpieces, many never displayed presented an intimate self-portrait of Latino America as captured through the lenses of 30 award-wi Mexican Fine Arts Center Museum; each museum simultaneously displayed part of the exhibition, A trolley connected the two publicly, illuminated Russia's grand and turbulent history. Exquisite handcrafting “pPears in Byzantine crosses, imperial Faberge eggs and a wealth of gem-encrusted crowns and icons—lavish testament to the splendor of Russian culture and the rich- ness of its natural resources, > t : : : tpn De 4 TV AI 14 45 VS tO » > Far-Reaching Impact At the core of the Museum are our collections — 91.5 million natural specimens and cultural objects that span the history of the Earth, each preserved and indexed for research, display and posterity. Through fieldwork around the world, Museum scientists expand the collec- tions at an average rate of almost 500 items each day. Scientific scholarship, such as automatic DNA sequencing, scanning electron microscopy, digital imaging and isotope geochemistry, elevates The Field Museum from a repository of the past to a living center for interpreting and communi- cating the wonders of the world. Our scientists and much of our collections and research data are readily accessible outside the Museum via publications, symposia, the Internet and other electronic media. 8.3 MILLION STUDENTS E-EXPERIENCE the fourth, fifth and sixth graders raced to THE MUSEUM | Outsi: Schoolchildren exonerate the dinosaur. 7he Sue Files is the across the United States and in other latest e-field trip produced by The Field countries participated in The Sue Files, an Expedition Company,™ which has placed interactive virtual adventure broadcast live kids onsite at a working dinosaur dig in via satellite, the Internet and public televi- Colorado and behind the scenes uncovering sion. Students faced a mystery: a scientist secrets of the Dead Sea Scrolls. Students can is missing, and Sue is the number one ask questions of Museum scientists and staff suspect. Using the scientific method and a during the broadcasts via toll-free telephone toolbox of paleontological techniques, call, fax or email. WEB SITE USAGE In Millions of Unique Visits WWW.FIELDMUSEUM.ORG | 0uisicic | Since we have room to display publicly only one percent of our collections, our Web site presents a solution for showcasing the Museum in all of its dimensions to people all over the world. Under the leader- ship of Dr. Robin Foster, Conservation Ecologist for Vascular Plants, we launched online Rapid Color Guides, a first-of-its- kind photographic reference designed for conservation botanists to use in the field to identify tropical species. Bill Stanley, Collection Manager for Mammals, is creat- ing an illustrated online guide to mammal identification, based on collections at the Museum, for his students in Tanzania. And Dr. Gregory Mueller, Associate Curator of Mycology and Chair of Botany, is collabo- rating on v-Plant, a botany collection for the digital age. USING DNA AS AN EVOLUTIONARY ROAD MAP) «~~ Unraveling the mysteries of life at the genetic level is the focus of our Pritzker Laboratory for Molecular Systematics and Evolution, one of the few multi-disciplinary facilities of its kind in the world. Field Museum faculty and visiting scientists use DNA analysis to complement traditional natural history investigative techniques and gain new AGATAATGGAGGTTAGTGTGAAATAATGATATTGTTATAATATTAATT TATCGATGCTACCAAATATCAT AGATAATGGAGGTTAGTGTGAAATAATGATATTGTTATAATATTAATTTATCGATGCTACCAAATATCATALTAGARATITGTCCTTTTTACAAAGAAATATGGAGTTATACCTITTGTAATIAG TIGA AG ATAATGGAGGTTAGTGTGAAATAATGATATTGTTATAATATTAATTTATCGAT GC TACCAAATATCATATTAGAAATITGTCCTTTTTACAAAGAAATATGGAGTTATACCTTTIGTAATIACTIGS AGATAATGGAGGTTAGTGTGAAATAATGATATTGTTATAATATTAATTIATCGATGCTACCAAATATCATATTAGAAATITGTCCTTTTTACAAAGAAATATGGAGTTATACCTTTTGTAATIAGTIGA 30 40 50 60 70 80 90 100 110 120 130 140 150 Fragment v = base selected AGATAATGGAGGTTAGTGI GAAATAATGATAT IG TATAATATIAATT TATCGATGC TAC GAAATATCATAT TAGAAATT TGTOCTITITACAAAGAAATATGGAGTTATACE TTTTGTAATTACTITGA RRA BE ee cee ae elt sa rohgvogesansgnanseesbitaiza Pe bfanrsoresnesetasae ee Sinemet beeen RR a renin Suweiiwsetateesenu steal PeAWnnpanssaaennalen ep acniieeesy eenw En position 54 insights into evolution and genetic diversity at all levels, from Neanderthals and early human migratory patterns to fruit fly speciation in Africa, Madagascar and the Seychelle islands. We use techniques such as polymerase chain reaction, DNA sequencing and cloning to analyze our more than 40,000 frozen tissue samples from the world’s plants and animals. Te peak Doe Ta, Se Ss ea Gare ee, en | eae) CI ATTAGAAATTTGTCCTTTTTACAAAGAAATATGGAGTTATACCTTTTGTAATTACTTIGA Shown is an electropherogram of a portion of the DNA sequence of a Madagascar songbird, analyzed as part of a current study in the Pritzker Laboratory of Molecular Systematics and Evolution by the Division of Birds. DNA sequences from many individual specimens and different populations of songbirds across Madagascar are being compared to discern patterns of evolution on this island. APPLYING THE MOST ADVANCED TECHNIQUES ©»°) Weare building an isotope geochemistry laboratory for geochemical studies and age dating of terrestrial and meteoritic samples, This lab will help Dr. Meenakshi Wadhwa, Associate Curator of Meteoritics and Mineralogy, better understand the early history of our solar system. In addition, we use the scanning electron microscope to study the physical properties of three-dimensional objects and specimens. It magnifies from 10 times to more than 20,000 times life size. The microscope has illuminated a variety of subjects—the body structures of millipedes, new species of shrews identified by their teeth and jaws and the evolution of flower- ing plants as revealed through fossils and live specimens. The Field Museum is a catalyst for understanding and conserving the world we live in now. Our leadership takes many forms, from initiating environmental action to spark- ing imaginations and promoting cultural understanding. Activities at the Museum are numerous and inclusive: é appearances by the Dalai Lama, Stephen Jay Gould, ¥ Jhumpa Lahiri, Julie Taymor, Zahi Hawass, Anna Quindlen, Elaine Pagels and Michael Eric Dyson: The Two of Us pre-school workshops; and Dozin’ with the Dinos family overnights. Programs outside our walls reach near and far: Field Ambassadors in Chicago Public Schools, Naturalist Certification courses for citizen scientists and preservation projects from the Amazonian lowlands BUILDING COMMUNITY AMONG NEIGHBORS | Outside | Our Center for Cultural Understanding and Change helps people in our home city use the Museum as a resource for connecting Chicago's diverse neighborhoods and improving urban life. The Center partners with dozens of community and civic organiza- tions, ethnic museums and cultural centers. Irs Urban Research Initiatives Local and Global Relevance to the forests of the Philippines. include an internship program for anthropologists-in-training, who conduct research for local organizations on issues of pressing concern to their communities. One recent study, in collaboration with Rabbi Philip Lefkowitz, head of Agudas Achim North Shore Congregation, addressed ways to preserve Russian-Jewish heritage in the face of Uptown gentrification. aa PROTECTING THREE MILLION ACRES OF THREATENED HABITAT | Outside | Through a Rapid Biological Inventory led by Dr. Debra Moskovits, Director of Environmental and Conservation Programs, Field Museum and in-country scientists identified thousands of plants and animals during three weeks in the remote reaches of the northern Cordillera Azul in central Peru. Twenty-eight of these species—and likely many more—are new to science. Based on outcomes of the survey and numerous collaborations, the Peruvian government is now including national parks as an alternative to logging and haphazard human settlement in this biologically rich area. Swift and collaborative response to threatened ecosystems is typical of the work of our Environmental and Conservation Programs, which mobilize the Museum's scientific and collection resources to fulfill urgent needs at regional, national and inter- national levels. SPECIES REGISTERED AT CORDILLERA AZUL Vascular Plants (Plantas Vasculares ) Mammals (Mamiferos ) Birds (Aves) Amphibians and Reptiles (Anfibios y Reptiles ) Fishes (Peces) ae City 4 od ow Total 1,616 71 523 82 93 PRESERVING BIOLOGICAL RICHES | outside | The Chicago region is home to some of the world’s best remnants of tallgrass prairies, oak savannas and prairie wetlands. The Field Museum is a found- ing member of Chicago Wilderness, an unprecedented coalition of more than 130 organizations dedicated to protecting the 200,000 acres of natural lands within the metropolitan area. The new Biodiversity Recovery Plan we helped develop outlines actions and priorities for restoring these globally prominent communities and securing their long- term survival. In 2000, we took lessons learned from Chicago Wilderness to Mexico City, Havana and the Brazilian Atlantic Forest. Lake Calumet is a local site of particular concern and potential, Here, globally endangered ecosystems survive amid heavy industry, toxic dumps and degraded lands. The Museum is a central player in major city and state efforts to reinvigorate Lake Calumet’s economy and quality of life by transforming its environmental culture. KICKING OFF WORLD MUSIC FESTIVAL: cuicaco 2000 |= © In collaboration with the city and local arts organizations, The Field Museum opened this second annual event with a free evening concert on our north steps. The 11-day fest invited all of Chicago to celebrate diversity in con- temporary culture and musical traditions, from the Latin beat of Casolando to the classical Indian movements of the Natyakalalayam Dance Company. 28 Financial Highlights REVENUE AND OTHER SUPPORT Year Ended December 31, 2000 Total Revenue $52,766,761* * Unaudited EXPENSES Year Ended December 31, 2000 Total Expenses $51,017,554" * Unaudited ENDOWMENT FUND MARKET VALUE Years Ended December 31 Auxiliary Enterprises 19.8% ............0+sseeere oe Admissions 19.6% ........- OR ne eee Investment EarningS 18.8% .......-.-sssseeersseereeeeees Chicago Park District 14% ............-ssseeereeereeenees Federal, State & Local Support 10% .........-.-++++ Contributions 8.3% ...... isswaite Fi aagnsnsaenciteaabaos cane MembershipS 3.3% ........ceeeeeeeesesenteeeerreeersrennees Group SaleS 1.9% .........+++eeeeeeee wabagnsties Feoanbb secede Sponsorships 1.6% Saar cir supp nsasaeses s Habke seam Py rv. Other Income 1.5% ........ Gear eests eters Ceoagrne GaabareDesei eh sekeee Education Program Fees 1.2%. Academic Affairs 19.8% ..........:sesseneserreeeeeress we General Services & Facilities 19.7% .........- Sethe Auxiliary Enterprises 14% ....... Givin rraealathie Public ServiceS 12% .......::ceeeeeeeeeneereeeene (panies Institutional Advancement 7% ......-..+++sssrereeereees Administration 4.7% ........:++08++ Ersibise Ete setsnenst oer In Millions $200 iter Meee Sct alln’ 192.8 si $190 ; : a = ee ee? ®eeeece 182.2 $180 co SS ee = ae’ $170 We. See 2 a eo a: ee tee: u $160 Se = Seas Se are aay te on $150 : —,e8° = Er Si ce a no yoo ag a a a SE oeS $130 PC hae < ioe: z ees: s ee $120 : © at ese SEE Se 96 97 98 99 00 BOARD OF TRUSTEES Officers Ronald J. Gidwitz Chairman Marshall Field Vice Chairman (Governance) Marshall B. Front Vice Chairman (Development) Sue Ling Gin Vice Chairman (External Affairs ) Wayne E. Hedien Vice Chairman (Finance) William C. Kunkler IIT Vice Chairman (Facilities and Administrative Services ) Neil S. Novich Vice Chairman (Information Technology) Miles D. White Vice Chairman (Collections and Research ) Linda Wolf Vice Chairman (Public Programs) Philip L. Harris Secretary John W. McCarter, Jr. President and Chief Executive Officer James L. Alexander Charles Benton Judith S. Block Norman R. Bobins Christopher D. Bowers John A. Canning Jr. Gery J. Chico Robin T. Colburn Michelle L. Collins James W. Compton Robert W. Crawford Jr. Dr. Dolores E. Cross Julian C. Day Jay Delaney Nina J. Fain Jack W. Fuller Jack M. Greenberg Barry G. Hastings Harlow N. Higinbotham Edward C. Hirschland Mellody Hobson William H. Kurtis Cary J. Malkin John A. Manzoni Scott P. Marks Jr. Miles L. Marsh Richard L. Measelle Hugo J. Melvoin Leo F. Mullin Barbara K. Pearlman Richard Pigott Peter B. Pond Robert A. Pritzker Lisa J. Redtegui John W. Rowe Timothy R. Schwertfeger Michael Scott Adele S. Simmons Faith A. Smith Laura S. Washington Robert L. Wesley Miles D. White William J. White Susan A. Willetts Sam Zell Life Trustees Mrs. T. Stanton Armour Robert O. Bass Gordon Bent Bowen Blair Willard L. Boyd Worley H. Clark Jr. Frank W. Considine Stanton R. Cook Mrs. Edwin DeCosta Thomas E, Donnelley II Mrs. David W. Grainger Mrs. Robert S. Hartman Richard M. Jones James J. O’Connor - John S. Runnells II William L. Searle Edward Byron Smith Mrs. Theodore D. Tieken Blaine J. Yarrington CREDITS Sue Sue at The Field Museum is made possible by McDonald’s Corporation. A major sponsor of Sue is Walt Disney World Resort. Additional support has been provided by the Illinois Department of Natural Resources / Illinois State Museum. The Elizabeth Morse Charitable Trust is the generous sponsor of this exhibition. “Sue” is a registered trademark of The Field Museum. Americanos: Latino Life in the United States The Chicago presentation was sponsored by ‘Target Stores and Marshall Field’s Project Imagine. Americanos, a project of Olmos Productions, was organized by the Smithsonian Institution Traveling Exhibition Service and the Smithsonian Center for Larino Initiatives. The exhibition was made possible through the generous support of Time Warner Inc. and U § WEST. Additional support was provided by Farmers Insurance. The Dead Sea Scrolls This exhibition was sponsored by Lilly Endowment Inc,, The Church of Jesus Christ of Latter-day Saints, The Fourth Presbyterian Church of Chicago, Chicago Sinai Congregation, the Archdiocese of Chicago and the Jewish United Fund/Jewish Federation of Metropolitan Chicago. Additional support was provid- ed by The Joseph and Bessie Feinberg Foundation, the Dorot Foundation, Claire and Gordon Prussian, Marshall and Doris Holleb and Fern and Manfred Steinfeld. This exhibition was indemnified by the Federal Council on the Arts and the Humanities. The Dead Sea Scrolls was co-organized by The Field Museum and the Israel Antiquities Authority. Underground Adventure Underground Adventure is made possible through the generosity of Monsanto, lead sponsor; The ConAgra Foundation; the National Science Foundation; and The Fort James Foundation. Other donors included the Chicago Park District; The Pfizer Foundation, Inc.; Abbott Laboratories; Prince Charitable Trusts; The ServiceMaster Company; Marion S. Searle/ The Searle Family Trust; and the Chicago Board of Trade Foundation, with additional funds from the Shell Oil Company Foundation, USX Foundation and anonymous donors. Artifacts and Specimens Inside front cover: Wooden mask, Ivory Coast, 19th/20th Century, gift of Robert Savage. Page 2: American Crow eggs, c. 1900. Page 4: John James Audubon original manuscript journal, 1826, gift of the Charles W. Palmer Family, 1999. Page 12: Pot sherd, eastern Shandong, China, c. 2000 BCE; 17-Year Cicada, Magicicada septendecum; Sue, Tyrannosaurus rex, ¢. 67 million years ago. Page 15: Pyem mask, Nigeria, 19th/20th Century, gift of Mr.and Mrs. Robert H. Stotz. Page 18: Psalms (Dead Sea Scrolls), Qumran, Israel, c, 30-50 CE; Harris Loan exhibit case “Great Horned Owl,” 1999. Page 19: Imperial presentation dipper, Moscow, Russia, 1755. Page 22: Flowering buds, Diplarpea paleacea, Natino, Colombia; Orange flower, Randia aurantiaca; Pink flower, Nymphaea. Page 23: Feathering beetle, family Priliidae. Page 26: Frog, Eleutherodactylus, Peru. Page 32: Hercules Beetle, Dynastes hercules. Photographers Mark Widhalm: inside front cover, pages 2, 4, 12, 15, 23 and 32 Robert Shaw: pages 1 and 27 Willard Clay: page 3 Jeff Sciortino: pages 6, 8, 10, 11, 16,18, 20 and 24 Linda Nicholas: page 12 Ira Block: page 13 John Weinstein: page 14 Kimberly Mazanek: pages 15 and 27 Antonio Pérez: page 19 Thomas Dubrock: page 19 Robin Foster: page 22 Tatzyana Wachter: page 22 Tim Plowman: page 22 Oliver Betz: page 23 William Alverson: page 26 H. Bradley Shaffer: page 26 THE FIELD MUSEUM SALUTES THE CHICAGO PARK DISTRICT FOR ITS GENEROUS AND LONG-STANDING SUPPORT OF THE MUSEUM AND ITS PROGRAMS. © 2001 The Field Museum. All rights reserved. €9 Printed on recycled paper | 34 What's next? We will continue to distinguish The Field Museum as one of the world’s best museums. We will deepen our impact in preserving the diversity of life through scholarship and environmental action. We will expand our service to the community through growth of our school programs, stimulating exhibitions, innovative partnerships and creative technology. a : | . i | ’ iy , hat i i ; \ ‘Bale ot v7 { | t § | LOCURTO AND ASSOCIATES * NARRATIVE COSTELLO COMMUNICATIONS, CHICAGO . :